6862 results
X-ray diffraction data for the Crystal structure of Enterovirus D68 3C protease determined via sulfur phasing
X-ray diffraction data for the Crystal structure of calcium-dependent protein kinase 1 (CDPK1) from Cryptosporidium parvum in complex with inhibitor WIN-1-158.
First author:
Seattle Structural Genomics Center for Infectious Disease (SSGCID) Seattle Structural Genomics Center for Infectious Disease
Uniprot: A3FQ16
Resolution: 2.21 Å
R/Rfree: 0.20/0.24
Uniprot: A3FQ16
Resolution: 2.21 Å
R/Rfree: 0.20/0.24
X-ray diffraction data for the Crystal structure of calcium-dependent protein kinase 1 (CDPK1) from Cryptosporidium parvum in complex with inhibitor BKI-1862.
First author:
Seattle Structural Genomics Center for Infectious Disease (SSGCID) Seattle Structural Genomics Center for Infectious Disease
Uniprot: A3FQ16
Resolution: 2.52 Å
R/Rfree: 0.21/0.26
Uniprot: A3FQ16
Resolution: 2.52 Å
R/Rfree: 0.21/0.26
X-ray diffraction data for the Crystal structure of calcium-dependent protein kinase 1 (CDPK1) from Cryptosporidium parvum in complex with inhibitor WIN-1-159.
First author:
Seattle Structural Genomics Center for Infectious Disease (SSGCID) Seattle Structural Genomics Center for Infectious Disease
Uniprot: A3FQ16
Resolution: 2.30 Å
R/Rfree: 0.21/0.25
Uniprot: A3FQ16
Resolution: 2.30 Å
R/Rfree: 0.21/0.25
X-ray diffraction data for the Crystal structure of calcium-dependent protein kinase 1 (CDPK1) from Cryptosporidium parvum in complex with inhibitor BKI-1708.
First author:
Seattle Structural Genomics Center for Infectious Disease (SSGCID) Seattle Structural Genomics Center for Infectious Disease
Uniprot: A3FQ16
Resolution: 2.20 Å
R/Rfree: 0.20/0.26
Uniprot: A3FQ16
Resolution: 2.20 Å
R/Rfree: 0.20/0.26
X-ray diffraction data for the Crystal structure of calcium-dependent protein kinase 1 (CDPK1) from Cryptosporidium parvum in complex with inhibitor BKI-1932.
First author:
Seattle Structural Genomics Center for Infectious Disease (SSGCID) Seattle Structural Genomics Center for Infectious Disease
Uniprot: A3FQ16
Resolution: 1.84 Å
R/Rfree: 0.19/0.21
Uniprot: A3FQ16
Resolution: 1.84 Å
R/Rfree: 0.19/0.21
X-ray diffraction data for the Crystal structure of calcium-dependent protein kinase 1 (CDPK1) from Cryptosporidium parvum in complex with inhibitor WIN-III-6.
First author:
Seattle Structural Genomics Center for Infectious Disease (SSGCID) Seattle Structural Genomics Center for Infectious Disease
Uniprot: A3FQ16
Resolution: 1.94 Å
R/Rfree: 0.19/0.23
Uniprot: A3FQ16
Resolution: 1.94 Å
R/Rfree: 0.19/0.23
X-ray diffraction data for the Crystal structure of Zika virus NS2B-NS3 protease determined via sulfur phasing
X-ray diffraction data for the Crystal structure of trypsin at 100 Kelvin with benzamidine (triplicate)
X-ray diffraction data for the KEAP1 complexed to cyclic peptide 33
X-ray diffraction data for the KEAP1 complexed to cyclic peptide 30
X-ray diffraction data for the KEAP1 complexed to cyclic peptide 34
X-ray diffraction data for the KOD-H4 DNA polymerase mutant in a binary complex with DNA:DNA containing two AtNA nucleotides
X-ray diffraction data for the Crystal Structure of ribosomal large subunit pseudouridine synthase D from Neisseria gonorrhoea
First author:
Seattle Structural Genomics Center for Infectious Disease (SSGCID)
Uniprot: B4RJW3
Resolution: 1.91 Å
R/Rfree: 0.17/0.19
Uniprot: B4RJW3
Resolution: 1.91 Å
R/Rfree: 0.17/0.19
X-ray diffraction data for the Crystal structure of Cysteinyl-tRNA synthetase (CysRS) from Plasmodium falciparum in complex with ADP (long soak)
First author:
Seattle Structural Genomics Center for Infectious Disease (SSGCID)
Uniprot: Q8IJP3
Resolution: 2.45 Å
R/Rfree: 0.19/0.22
Uniprot: Q8IJP3
Resolution: 2.45 Å
R/Rfree: 0.19/0.22
X-ray diffraction data for the Crystal Structure of ATP phosphoribosyltransferase from Bordetella pertussis
First author:
Seattle Structural Genomics Center for Infectious Disease (SSGCID)
Uniprot: Q7VSZ2
Resolution: 1.55 Å
R/Rfree: 0.19/0.22
Uniprot: Q7VSZ2
Resolution: 1.55 Å
R/Rfree: 0.19/0.22
X-ray diffraction data for the Crystal structure of Coxsackievirus A16 (G-10) 2A protease determined via sulfur phasing
X-ray diffraction data for the Crystal structure of Ami1 from M. tuberculosis in complex with a tetrazole compound
X-ray diffraction data for the Crystal structure of Borneoldehydrogenase ancestor N39
First author:
C.P.O. Helmer
Resolution: 1.85 Å
R/Rfree: 0.17/0.21
Resolution: 1.85 Å
R/Rfree: 0.17/0.21
X-ray diffraction data for the Helicobacter pylori cysteine rich protein B (hcpB)
X-ray diffraction data for the Crystallizing extracellular protein reveals paths for silver mineralization and recovery
X-ray diffraction data for the Crystal structure of PHICD111_20024_EAD.
X-ray diffraction data for the Crystal structure of C. merolae LAMMER-like dual specificity kinase (CmLIK) kinase domain
X-ray diffraction data for the Neutralizing monoclonal antibody Fab fragment for human leptin
First author:
D.R. Tomchick
Resolution: 3.30 Å
R/Rfree: 0.27/0.32
Resolution: 3.30 Å
R/Rfree: 0.27/0.32
X-ray diffraction data for the Crystal Structure of L-erythrulose-1-phosphate isomerase from Brucella melitensis (P1 form)
First author:
Seattle Structural Genomics Center for Infectious Disease (SSGCID)
Uniprot: Q2YIQ6
Resolution: 1.60 Å
R/Rfree: 0.16/0.18
Uniprot: Q2YIQ6
Resolution: 1.60 Å
R/Rfree: 0.16/0.18
X-ray diffraction data for the Crystal Structure of L-erythrulose-1-phosphate isomerase from Brucella melitensis (P21 form)
First author:
Seattle Structural Genomics Center for Infectious Disease (SSGCID)
Uniprot: Q2YIQ6
Resolution: 2.15 Å
R/Rfree: 0.18/0.22
Uniprot: Q2YIQ6
Resolution: 2.15 Å
R/Rfree: 0.18/0.22
X-ray diffraction data for the Drosophila melanogaster setdb1-tuor domain
X-ray diffraction data for the Co-crystal structure of human CARM1 in complex with MT556 inhibitor
X-ray diffraction data for the Crystal structure of the WDR domain of human DCAF1 in complex with OICR-6766
X-ray diffraction data for the Co-crystal structure of 53BP1 tandem Tudor domains in complex with UNC8531
X-ray diffraction data for the Crystal structure of Capsular polysaccharide biosynthesis protein from Bordetella pertussis in complex with NAD and uridine-diphosphate-n-acetylgalactosamine (cocrystallization)
First author:
Seattle Structural Genomics Center for Infectious Disease (SSGCID)
Uniprot: Q7TTK0
Resolution: 1.70 Å
R/Rfree: 0.15/0.18
Uniprot: Q7TTK0
Resolution: 1.70 Å
R/Rfree: 0.15/0.18
X-ray diffraction data for the Crystal Structure of serine/threonine-protein kinase (AEK1) T376D, S395D Mutant from Trypanosoma brucei (AMP-PNP)
First author:
Seattle Structural Genomics Center for Infectious Disease (SSGCID)
Uniprot: Q582V7
Resolution: 2.15 Å
R/Rfree: 0.22/0.25
Uniprot: Q582V7
Resolution: 2.15 Å
R/Rfree: 0.22/0.25
X-ray diffraction data for the Crystal structure of bacterial extracellular solute-binding protein from Bordetella bronchiseptica RB50
First author:
C. Chang
Resolution: 1.55 Å
R/Rfree: 0.17/0.19
Resolution: 1.55 Å
R/Rfree: 0.17/0.19
X-ray diffraction data for the Crystal Structure of cyclophilin B, from Brugia malayi (K5H/S166A mutant)
First author:
Seattle Structural Genomics Center for Infectious Disease (SSGCID)
Uniprot: A0A0J9XUF2
Resolution: 1.25 Å
R/Rfree: 0.11/0.13
Uniprot: A0A0J9XUF2
Resolution: 1.25 Å
R/Rfree: 0.11/0.13
X-ray diffraction data for the Crystal Structure of serine/threonine-protein kinase (AEK1) from Trypanosoma cruzi in complex ADP
First author:
Seattle Structural Genomics Center for Infectious Disease (SSGCID)
Uniprot: Q4E2L0
Resolution: 2.60 Å
R/Rfree: 0.21/0.27
Uniprot: Q4E2L0
Resolution: 2.60 Å
R/Rfree: 0.21/0.27
X-ray diffraction data for the Crystal structure of Phosphoribosylaminoimidazole carboxylase from Burkholderia xenovorans (AMP, ADP and sulfate complex)
First author:
Seattle Structural Genomics Center for Infectious Disease (SSGCID)
Uniprot: Q13UJ9
Resolution: 2.49 Å
R/Rfree: 0.20/0.25
Uniprot: Q13UJ9
Resolution: 2.49 Å
R/Rfree: 0.20/0.25
X-ray diffraction data for the Crystal structure of E3 ligase in complex with peptide
X-ray diffraction data for the Crystal structure of E3 ligase
X-ray diffraction data for the CARM1 in complex with arg-aDMA analog
X-ray diffraction data for the Xray crystal structure of Vientovirus FB Rep endonuclease domain 2-114 with Mg2+ ion
X-ray diffraction data for the Crystal structure of a glyceraldehyde-3-phosphate dehydrogenase from Neisseria gonorrhoeae in complex with NAD (P1 form2)
First author:
Seattle Structural Genomics Center for Infectious Disease (SSGCID) Seattle Structural Genomics Center for Infectious Disease
Uniprot: B4RPP8
Resolution: 3.09 Å
R/Rfree: 0.18/0.23
Uniprot: B4RPP8
Resolution: 3.09 Å
R/Rfree: 0.18/0.23
X-ray diffraction data for the Crystal structure of an Iole protein from Brucella melitensis (hexagonal P form)
First author:
Seattle Structural Genomics Center for Infectious Disease (SSGCID)
Uniprot: Q8YCG0
Resolution: 1.98 Å
R/Rfree: 0.25/0.29
Uniprot: Q8YCG0
Resolution: 1.98 Å
R/Rfree: 0.25/0.29
X-ray diffraction data for the Crystal Structure of a Ribokinase from Brucella suis in complex with ADP
First author:
Seattle Structural Genomics Center for Infectious Disease (SSGCID)
Uniprot: A0A0H3GDY9
Resolution: 2.85 Å
R/Rfree: 0.19/0.26
Uniprot: A0A0H3GDY9
Resolution: 2.85 Å
R/Rfree: 0.19/0.26
X-ray diffraction data for the Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing separate insert strand with sequence GACGGTAATT
X-ray diffraction data for the Carbohydrate-bound structure of alpha-glucan phosphorylase from Crocosphaera subtropica ATCC 51142
X-ray diffraction data for the Crystal structure of M. smegmatis GMP reductase with XMP* intermidiate in complex with NADP+ and IMP.
X-ray diffraction data for the KEAP1 complexed to linear peptide 6
X-ray diffraction data for the Mutant M298C6a of the small laccase (SLAC) from Streptomyces coelicolor
X-ray diffraction data for the GlfT2 from Nocardia brasiliensis Bound to Galf Trisaccharide
X-ray diffraction data for the GlfT2 from Nocardia brasiliensis Bound to Galf Tetrasaccharide
X-ray diffraction data for the Crystal Structure of an exported phospholipid binding protein from Bordetella pertussis in complex with Di-palmitoyl-3-sn-phosphatidylethanolamine (DPPE), P43 Form 1
First author:
Seattle Structural Genomics Center for Infectious Disease (SSGCID)
Uniprot: Q7VSZ6
Resolution: 1.80 Å
R/Rfree: 0.21/0.25
Uniprot: Q7VSZ6
Resolution: 1.80 Å
R/Rfree: 0.21/0.25
X-ray diffraction data for the Crystal Structure of an exported phospholipid binding protein from Bordetella pertussis in complex with Di-palmitoyl-3-sn-phosphatidylethanolamine (DPPE), P43 form 2
First author:
Seattle Structural Genomics Center for Infectious Disease (SSGCID)
Uniprot: Q7VSZ6
Resolution: 1.51 Å
R/Rfree: 0.18/0.21
Uniprot: Q7VSZ6
Resolution: 1.51 Å
R/Rfree: 0.18/0.21
X-ray diffraction data for the Crystal structure of hen egg white lysozyme
X-ray diffraction data for the Crystal structure of hen egg white lysozyme
X-ray diffraction data for the Crystal structure of hen egg white lysozyme
X-ray diffraction data for the Crystal structure of hen egg white lysozyme
X-ray diffraction data for the Crystal structure of hen egg white lysozyme
X-ray diffraction data for the Crystal structure of hen egg white lysozyme
X-ray diffraction data for the Crystal structure of hen egg white lysozyme
X-ray diffraction data for the Crystal structure of hen egg white lysozyme
X-ray diffraction data for the Crystal structure of hen egg white lysozyme
X-ray diffraction data for the Crystal structure of hen egg white lysozyme
X-ray diffraction data for the Crystal structure of hen egg white lysozyme
X-ray diffraction data for the Crystal structure of hen egg white lysozyme
X-ray diffraction data for the Crystal structure of hen egg white lysozyme
X-ray diffraction data for the Crystal structure of hen egg white lysozyme
X-ray diffraction data for the Crystal structure of hen egg white lysozyme
X-ray diffraction data for the Crystal structure of hen egg white lysozyme
X-ray diffraction data for the Crystal structure of hen egg white lysozyme
X-ray diffraction data for the Crystal structure of hen egg white lysozyme
X-ray diffraction data for the Crystal structure of hen egg white lysozyme
X-ray diffraction data for the Crystal structure of hen egg white lysozyme
X-ray diffraction data for the Crystal structure of hen egg white lysozyme
X-ray diffraction data for the Crystal structure of hen egg white lysozyme
X-ray diffraction data for the Crystal structure of hen egg white lysozyme
X-ray diffraction data for the Crystal structure of hen egg white lysozyme
X-ray diffraction data for the Crystal structure of hen egg white lysozyme
X-ray diffraction data for the Crystal structure of hen egg white lysozyme
X-ray diffraction data for the Crystal structure of hen egg white lysozyme
X-ray diffraction data for the Crystal structure of hen egg white lysozyme
X-ray diffraction data for the Crystal structure of hen egg white lysozyme
X-ray diffraction data for the Crystal structure of hen egg white lysozyme
X-ray diffraction data for the Isoreticular co-crystal 1 with symmetrical expanded duplex (42mer) containing insert sequence ACCCTTCTATGACCTACTCCA
X-ray diffraction data for the Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence TGATGAGCAG
X-ray diffraction data for the Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence TGATGAGCAG and loaded with ultrabithorax homeodomain
X-ray diffraction data for the Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence TGATGAGCAG and loaded with Even-skipped homeodomain
X-ray diffraction data for the Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence TGATGAGCAG and loaded with Even-skipped homeodomain
X-ray diffraction data for the Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence TGATGAGCAG and loaded with Engrailed homeodomain enhanced Green fluorescent protein fusion
X-ray diffraction data for the Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence TAATTAGGCCG and loaded with ultrabithorax homeodomain
X-ray diffraction data for the Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence TAATTAGGCCG and loaded with Even-skipped homeodomain
X-ray diffraction data for the Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence TAATTAGGCCG and loaded with Antennapedia homeodomain
X-ray diffraction data for the Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence GCTTGATGAG, crystal soaked in alternate solvent prior to diffraction
X-ray diffraction data for the Isoreticular, Porous co-crystal of Replication Initiator Protein REPE54 and asymmetrical expanded duplex (31mer) containing the cognate REPE54 sequence and additional expansion sequence
X-ray diffraction data for the Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence CTAATTAGGC, crystal soaked in alternate solvent prior to diffraction
X-ray diffraction data for the Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence CTAATTAGGC
X-ray diffraction data for the Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence CTAATTAGGC and loaded with Even-skipped homeodomain
X-ray diffraction data for the Isoreticular co-crystal of Replication Initiator Protein REPE54 and asymmetrical expanded duplex (31mer) containing the cognate REPE54 sequence, and additional T-A rich sequence with 5' terminal phosphates. Two copies of Even-skipped homeodomain loaded post-crystallization
X-ray diffraction data for the Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence CGTAATTAGG
X-ray diffraction data for the Isoreticular co-crystal 1 with symmetrical expanded duplex (31mer) containing insert sequence ACGGTAATTA
X-ray diffraction data for the Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence CGCGCGCGCG
